| Internal ID | 936039 | Source Database | PRODORIC SI001052 |
| Feature Type | site |
| Name |
TTAT-Box
|
| Sequence |
CTTATACCTACCTGTCTGGTTTTTA Look for more occurrences |
| Start | 3203858 |
| End | 3203882 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
|
Genetic and physiological characterization of ohr, encoding a protein involved in organic hydroperoxide resistance in Pseudomonas aeruginosa.
Ochsner UA, Hassett DJ, Vasil ML
J. Bacteriol. 2001 Jan;183(2):773-8
PubMed ID: 11133975
|