| Internal ID | 935692 | Source Database | PRODORIC SI001020 |
| Feature Type | site |
| Name |
lux-box-like sequence (lasR binding site)
|
| Sequence |
AGCCTTGCCGATACGGCAAA Look for more occurrences |
| Start | 3890721 |
| End | 3890740 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
|
| Additional Comments |
|
Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa.
Pesci EC, Pearson JP, Seed PC, Iglewski BH
J. Bacteriol. 1997 May;179(10):3127-32
PubMed ID: 9150205
|