| Internal ID | 19093857 | Source Database | TransTermHP TERM 692 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 692
|
| Sequence |
GGCCAACGCTTAGCGTTGGCC Look for more occurrences |
| Start | 3220423 |
| End | 3220443 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas trivialis strain IHBB745, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCACTCAATAAAAAA(5' tail) GGCCAACGC(5' stem) TAA(loop) GCGTTGGCC(3' stem) TTTTTTGTGTTTGCG(3' tail). Confidence: 100. opp_overlap 3220423 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|