| Internal ID | 19093348 | Source Database | TransTermHP TERM 16 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 16
|
| Sequence |
GCCGACCCCCTTGGGGGTCGGC Look for more occurrences |
| Start | 66097 |
| End | 66118 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas parafulva strain YAB-1 contig9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGCTGTTATCAA(5' tail) GCCGACCCC(5' stem) CTTG(loop) GGGGTCGGC(3' stem) TTTTTTTTGGTTTCG(3' tail). Confidence: 100. opp_overlap 66097 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|