Internal ID | 19089830 | Source Database | TransTermHP TERM 1608 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1608
|
Sequence |
CGCCGGGCTGATGCCCGGCG Look for more occurrences |
Start | 6295784 |
End | 6295803 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain F22031, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGGCGGAAACGAAAA(5' tail) CGCCGGGC(5' stem) TGAT(loop) GCCCGGCG(3' stem) TTTTTCATTGCGCAC(3' tail). Confidence: 100. opp_overlap 6295784 6295779 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|