| Internal ID | 19088059 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
ACGCGTCGCTGATCCTGCGACGCGC Look for more occurrences |
| Start | 54262 |
| End | 54286 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas viridiflava strain LMCA8 contig_65, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGGGTATCAAAAAAA(5' tail) GCGCGTCGCAG(5' stem) GAT(loop) CAGCGACGCGT(3' stem) CGGGCGAGCGGGCAT(3' tail). Confidence: 100. overlap 54263 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|