| Internal ID | 19087609 | Source Database | TransTermHP TERM 39 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 39
|
| Sequence |
CAAAGGCACCCGTTGGGTGCCTTTG Look for more occurrences |
| Start | 241910 |
| End | 241934 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas viridiflava strain LMCA8 contig_29, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGTCGTTTAAAACA(5' tail) CAAAGGCACCC(5' stem) GTT(loop) GGGTGCCTTTG(3' stem) CTTTTATGGGCGTTC(3' tail). Confidence: 100. opp_overlap 241908 241910 241914, overlap 241908 241909 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|