| Internal ID | 19087293 | Source Database | TransTermHP TERM 61 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 61
|
| Sequence |
CGCCCGGGCGGTCATCGCCTGGGCG Look for more occurrences |
| Start | 284720 |
| End | 284744 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas viridiflava strain LMCA8 contig_11, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGTAGAAATAACAA(5' tail) CGCCCAGGCGA(5' stem) TGA(loop) CCGCCCGGGCG(3' stem) TTTTTTGGGGCGATG(3' tail). Confidence: 100. opp_overlap 284720 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|