| Internal ID | 19085905 | Source Database | TransTermHP TERM 993 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 993
|
| Sequence |
GCCGGTCCATTCTTGGACCGGC Look for more occurrences |
| Start | 4924800 |
| End | 4924821 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas veronii strain R4 scaffold00001, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGTTGTTACCAA(5' tail) GCCGGTCCA(5' stem) TTCT(loop) TGGACCGGC(3' stem) TTTTTATTGCCTGCG(3' tail). Confidence: 100. opp_overlap 4924800 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|