| Internal ID | 19085320 | Source Database | TransTermHP TERM 38 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 38
|
| Sequence |
GCCAACCCACGAGGGTTGGC Look for more occurrences |
| Start | 137098 |
| End | 137117 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas veronii strain R4 scaffold00001, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCGCCAACAAAAAA(5' tail) GCCAACCC(5' stem) TCGT(loop) GGGTTGGC(3' stem) TTTTTAGCACAGCGA(3' tail). Confidence: 100. opp_overlap 137098 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|