| Internal ID | 19085177 | Source Database | TransTermHP TERM 155 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 155
|
| Sequence |
TAAAGCCCGATAATTATCGGGCTTTA Look for more occurrences |
| Start | 655299 |
| End | 655324 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas tuomuerensis strain JCM 14085 PT85_4, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAATAATTACTCTAA(5' tail) TAAAGCCCGAT(5' stem) AATT(loop) ATCGGGCTTTA(3' stem) TTTTTTATTCGAGAC(3' tail). Confidence: 100. opp_overlap 655303 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|