Internal ID | 19084446 | Source Database | TransTermHP TERM 138 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 138
|
Sequence |
GGCCAACGCAAGCGTTGGCC Look for more occurrences |
Start | 500470 |
End | 500489 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas taetrolens strain DSM 21104 4_596648_47.1758, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGCGCAATAAAAAA(5' tail) GGCCAACG(5' stem) CAAG(loop) CGTTGGCC(3' stem) TTTTTTATTTGTATT(3' tail). Confidence: 100. opp_overlap 500470, overlap 500460 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|