Internal ID | 19080011 | Source Database | TransTermHP TERM 18 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 18
|
Sequence |
CGGAGCGTGTTTCGCGCTCCG Look for more occurrences |
Start | 48037 |
End | 48057 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas syringae pv. tomato strain NYS-T1 Contig20, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTCCTTCAGGGAGAA(5' tail) CGGAGCGCG(5' stem) AAA(loop) CACGCTCCG(3' stem) TCGGGGATTTATTCG(3' tail). Confidence: 95. opp_overlap 48053 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|