| Internal ID | 19079831 | Source Database | TransTermHP TERM 16 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 16
|
| Sequence |
CCCTCTGCGCCGTAAAGCCAGAGGG Look for more occurrences |
| Start | 39100 |
| End | 39124 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. tomato strain NYS-T1 Contig12, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTGTTTGAAACCAAG(5' tail) CCCTCTGCGC(5' stem) CGTAAA(loop) GC-CAGAGGG(3' stem) TTTTTTTCGAGATGA(3' tail). Confidence: 100. gap 1, opp_overlap 39100 39099 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|