Internal ID | 19077982 | Source Database | TransTermHP TERM 794 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 794
|
Sequence |
GCCGACCCGGCAACGGGTCGGC Look for more occurrences |
Start | 3667280 |
End | 3667301 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas syringae pv. syringae HS191, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGGGATTATTGAAA(5' tail) GCCGACCCG(5' stem) GCAA(loop) CGGGTCGGC(3' stem) TTTTTTTTTGCCTGT(3' tail). Confidence: 100. opp_overlap 3667280 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|