Internal ID | 19077864 | Source Database | TransTermHP TERM 617 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 617
|
Sequence |
GCCCCGTGATCGCTCACGGGGC Look for more occurrences |
Start | 2602270 |
End | 2602291 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas syringae pv. syringae HS191, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCGGTAAACGAAAA(5' tail) GCCCCGTGA(5' stem) GCGA(loop) TCACGGGGC(3' stem) TTTTTGCTTTCTACG(3' tail). Confidence: 100. opp_overlap 2602270 2602264 2602263, overlap 2602264 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|