| Internal ID | 19077863 | Source Database | TransTermHP TERM 616 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 616
|
| Sequence |
GCCCCGTGAGCGATCACGGGGC Look for more occurrences |
| Start | 2602270 |
| End | 2602291 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. syringae HS191, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGGTAAACGAAAA(5' tail) GCCCCGTGA(5' stem) GCGA(loop) TCACGGGGC(3' stem) TTTTTGCTTTCTACG(3' tail). Confidence: 100. opp_overlap 2602264 2602270, overlap 2602264 2602263 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|