| Internal ID | 19069721 | Source Database | TransTermHP TERM 1 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1
|
| Sequence |
GCCCAAGCGAAAGCAAGGGC Look for more occurrences |
| Start | 13471 |
| End | 13490 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri strain NT0128 272_381214_55044910_233____135, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCAAAAAATTGAAA(5' tail) GCCCAAGC(5' stem) GAAA(loop) GCAAGGGC(3' stem) TTTTTATTTTGACCG(3' tail). Confidence: 90. opp_overlap 13471 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|