Internal ID | 19061939 | Source Database | TransTermHP TERM 1 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1
|
Sequence |
TGGGTGTGAGTATTCACACCCA Look for more occurrences |
Start | 2754 |
End | 2775 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. RIT288 contigs22, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTAGATATTGAAAAA(5' tail) TGGGTGTGA(5' stem) ATAC(loop) TCACACCCA(3' stem) TTTTCGGCGCAGCCT(3' tail). Confidence: 100. opp_overlap 2754 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|