| Internal ID | 19061252 | Source Database | TransTermHP TERM 117 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 117
|
| Sequence |
GGCGATCCGTGGGGATCGCC Look for more occurrences |
| Start | 391346 |
| End | 391365 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. RIT288 contigs1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGAAGTACAAAAAA(5' tail) GGCGATCC(5' stem) GTGG(loop) GGATCGCC(3' stem) TTTTTATTGGGCTGA(3' tail). Confidence: 100. opp_overlap 391346 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|