| Internal ID | 19056720 | Source Database | TransTermHP TERM 765 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 765
|
| Sequence |
CGCGACAGGCGACTGTCGCG Look for more occurrences |
| Start | 2892468 |
| End | 2892487 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. MRSN12121, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAACCCACACACAA(5' tail) CGCGACAG(5' stem) GCGA(loop) CTGTCGCG(3' stem) TTTTTTTTCGTGGGT(3' tail). Confidence: 100. opp_overlap 2892468 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|