| Internal ID | 19053181 | Source Database | TransTermHP TERM 174 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 174
|
| Sequence |
GGTCGCCCCGAGGGGCGACC Look for more occurrences |
| Start | 681879 |
| End | 681898 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. KG01 sole5_c1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCCGGCGGTTTCCAG(5' tail) GGTCGCCC(5' stem) CGAG(loop) GGGCGACC(3' stem) TTTAACGTGCAGATC(3' tail). Confidence: 95. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|