| Internal ID | 19052110 | Source Database | TransTermHP TERM 6 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 6
|
| Sequence |
GAACGCCGCCCCATGGGCGGCGTTC Look for more occurrences |
| Start | 14212 |
| End | 14236 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. HMP271 Pseudomonas_HMP271_contig_9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AACACGCAGATATGA(5' tail) GAACGCCGCCC(5' stem) ATG(loop) GGGCGGCGTTC(3' stem) TCGTCTGTGGCTCAG(3' tail). Confidence: 100. opp_overlap 14209 14215, overlap 14209 14215 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|