| Internal ID | 19049735 | Source Database | TransTermHP TERM 18 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 18
|
| Sequence |
GGGCGCCTTGGCGGGCGCCC Look for more occurrences |
| Start | 43405 |
| End | 43424 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. FGI182, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGGTATTTAGGGAGG(5' tail) GGGCGCCT(5' stem) TGGC(loop) GGGCGCCC(3' stem) TTTCTGATTTCATCT(3' tail). Confidence: 93. overlap 43401 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|