Internal ID | 19049564 | Source Database | TransTermHP TERM 34 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 34
|
Sequence |
CCGGCGCCCCAGGGCGCCGG Look for more occurrences |
Start | 95533 |
End | 95552 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. FeS53a scaffold6.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCACCGCTTCACCCA(5' tail) CCGGCGCC(5' stem) CCAG(loop) GGCGCCGG(3' stem) TTTTCGTTTGGGCGA(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|