Internal ID | 19048914 | Source Database | TransTermHP TERM 5 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 5
|
Sequence |
CCGACCCAGGCAACTGGGTCGG Look for more occurrences |
Start | 8250 |
End | 8271 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. FeS53a scaffold16.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCAGGCAATAAAAAA(5' tail) CCGACCCAG(5' stem) TTGC(loop) CTGGGTCGG(3' stem) TTTCAGGTAAAAGCC(3' tail). Confidence: 100. opp_overlap 8201 8250 8267 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|