| Internal ID | 19048913 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
CCGACCCAGTTGCCTGGGTCGG Look for more occurrences |
| Start | 8250 |
| End | 8271 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. FeS53a scaffold16.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAGGCAATAAAAAA(5' tail) CCGACCCAG(5' stem) TTGC(loop) CTGGGTCGG(3' stem) TTTCAGGTAAAAGCC(3' tail). Confidence: 90. opp_overlap 8250, overlap 8201 8267 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|