| Internal ID | 19048912 | Source Database | TransTermHP TERM 2 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 2
|
| Sequence |
CCCGCCTCCCATTCGGGTGGCGGG Look for more occurrences |
| Start | 8188 |
| End | 8211 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. FeS53a scaffold16.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCGCATCCAGAAGA(5' tail) CCCGCCTCCC(5' stem) ATTC(loop) GGGTGGCGGG(3' stem) TTTTTTATTGCCGGC(3' tail). Confidence: 100. opp_overlap 8188 8186, overlap 8201 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|