| Internal ID | 19043862 | Source Database | TransTermHP TERM 47 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 47
|
| Sequence |
GCCGCCGAAGTGTTAACTGCGGCGGC Look for more occurrences |
| Start | 157828 |
| End | 157853 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. DSM 28140 1_831734_30.8673, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGTTCAACTAATA(5' tail) GCCGCCGCAGT(5' stem) TAAC(loop) ACTTCGGCGGC(3' stem) TTTTTAGTGCCTGTT(3' tail). Confidence: 95. opp_overlap 157828, overlap 157826 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|