| Internal ID | 19040697 | Source Database | TransTermHP TERM 27 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 27
|
| Sequence |
CGGCCTGGCCTAGTCCAGGCCG Look for more occurrences |
| Start | 182185 |
| End | 182206 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. ARP3 contig7, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTTGATACATGATTG(5' tail) CGGCCTGG(5' stem) CCTAGT(loop) CCAGGCCG(3' stem) TTTTCATTTGTGCTT(3' tail). Confidence: 95. opp_overlap 182179 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|