| Internal ID | 19039672 | Source Database | TransTermHP TERM 113 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 113
|
| Sequence |
GGCCCGCCATCCGGCGGGCC Look for more occurrences |
| Start | 339530 |
| End | 339549 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. AAC Scaffold8, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGCCAGCGCAAAA(5' tail) GGCCCGCC(5' stem) ATCC(loop) GGCGGGCC(3' stem) TTTTCGTTTGTGCAG(3' tail). Confidence: 100. opp_overlap 339530, overlap 339523 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|