| Internal ID | 19038772 | Source Database | TransTermHP TERM 223 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 223
|
| Sequence |
CGCGGCCCGGCATTGTCCGGGCCGCG Look for more occurrences |
| Start | 732297 |
| End | 732322 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. AAC Scaffold1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCCCGCCCTGCCA(5' tail) CGCGGCCCGG(5' stem) CATTGT(loop) CCGGGCCGCG(3' stem) TCGTTTCCGGCTATC(3' tail). Confidence: 91. overlap 732288 732292 732294 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|