| Internal ID | 19034758 | Source Database | TransTermHP TERM 114 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 114
|
| Sequence |
GCCCCCTGATCTTCAGGGGGC Look for more occurrences |
| Start | 673227 |
| End | 673247 |
| Strand | - |
| Genomic Context | Located within gene ligD |
| Replicon | Pseudomonas sp. 12M76_air. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GACAGCCCCAAAAAA(5' tail) GCCCCCTGA(5' stem) AGA(loop) TCAGGGGGC(3' stem) TTTTGCGTTCAGCTG(3' tail). Confidence: 100. opp_overlap 673227 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|