Internal ID | 19034757 | Source Database | TransTermHP TERM 113 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 113
|
Sequence |
GCCCCCTGAAGATCAGGGGGC Look for more occurrences |
Start | 673227 |
End | 673247 |
Strand | + |
Genomic Context | Located within gene ligD |
Replicon | Pseudomonas sp. 12M76_air. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GACAGCCCCAAAAAA(5' tail) GCCCCCTGA(5' stem) AGA(loop) TCAGGGGGC(3' stem) TTTTGCGTTCAGCTG(3' tail). Confidence: 100. opp_overlap 673227 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|