| Internal ID | 19033958 | Source Database | TransTermHP TERM 793 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 793
|
| Sequence |
CTGCCGCATTCTCCGGAATGCGGCAG Look for more occurrences |
| Start | 3450488 |
| End | 3450513 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. 11/12A GQ39DRAFT_scf7180000000022_quiver_dupTrim_8682.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGATGACCGCTCTA(5' tail) CTGCCGCATTC(5' stem) TCCG(loop) GAATGCGGCAG(3' stem) TTTCCCGCCCCTTTG(3' tail). Confidence: 100. opp_overlap 3450477, overlap 3450507 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|