| Internal ID | 19031973 | Source Database | TransTermHP TERM 3 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 3
|
| Sequence |
CGCCCGGCCTTTGGTCGGGCG Look for more occurrences |
| Start | 18176 |
| End | 18196 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas simiae strain MEB105 contig_11, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCCGCAAACAAAAA(5' tail) CGCCCGACC(5' stem) AAA(loop) GGCCGGGCG(3' stem) TTAATTTCTCGGGCA(3' tail). Confidence: 100. opp_overlap 18176 18172 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|