| Internal ID | 19021651 | Source Database | TransTermHP TERM 905 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 905
|
| Sequence |
CGCCCGGCCCTGGCCGGGCG Look for more occurrences |
| Start | 4573160 |
| End | 4573179 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida strain PA14H7 Circular_chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCCCCGAGAATGAA(5' tail) CGCCCGGC(5' stem) CCTG(loop) GCCGGGCG(3' stem) TTTTCGTTTGCGGGT(3' tail). Confidence: 100. opp_overlap 4573142 4573160 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|