| Internal ID | 19021132 | Source Database | TransTermHP TERM 153 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 153
|
| Sequence |
GCCGACCCACTTGTGGGTCGGC Look for more occurrences |
| Start | 586212 |
| End | 586233 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida strain PA14H7 Circular_chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCGGCAACAAAAAA(5' tail) GCCGACCCA(5' stem) CAAG(loop) TGGGTCGGC(3' stem) TTCCAATAACAATCC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|