Internal ID | 19010070 | Source Database | TransTermHP TERM 23 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 23
|
Sequence |
GAAAGCCCGCGAAAGCGGGCTTTC Look for more occurrences |
Start | 109461 |
End | 109484 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas plecoglossicida NBRC 103162 = DSM 15088 strain NBRC 103162, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGATCTGCAGCCAAA(5' tail) GAAAGCCCGC(5' stem) TTTC(loop) GCGGGCTTTC(3' stem) TTTCGAGCGGTTTCT(3' tail). Confidence: 95. opp_overlap 109450 109461 109465, overlap 109465 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|