| Internal ID | 19009023 | Source Database | TransTermHP TERM 243 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 243
|
| Sequence |
GCCGACCCATTCGTGGGTCGGC Look for more occurrences |
| Start | 1102871 |
| End | 1102892 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas parafulva strain CRS01-1, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GACGCGCATAAAAAA(5' tail) GCCGACCCA(5' stem) CGAA(loop) TGGGTCGGC(3' stem) TTCTCAATAATCCGT(3' tail). Confidence: 100. opp_overlap 1102871 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|