| Internal ID | 19008270 | Source Database | TransTermHP TERM 54 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 54
|
| Sequence |
GCCCGCCATCTCAGATGGCGGGC Look for more occurrences |
| Start | 163899 |
| End | 163921 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas oryzihabitans strain RIT370 contig7, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCAGACAAACAAAAA(5' tail) GCCCGCCATC(5' stem) TGA(loop) GATGGCGGGC(3' stem) TTTTTGTTTGCTCCG(3' tail). Confidence: 100. opp_overlap 163899 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|