Internal ID | 18998890 | Source Database | TransTermHP TERM 66 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 66
|
Sequence |
TGCCCCGCCGTTTTCACGGCGGGGCA Look for more occurrences |
Start | 218524 |
End | 218549 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas lini strain DSM 16768 8_312049_22.9628, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTGCACATAAAAAAA(5' tail) TGCCCCGCCGT(5' stem) TTTC(loop) ACGGCGGGGCA(3' stem) TTTTTATAACGTTGA(3' tail). Confidence: 100. opp_overlap 218524 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|