| Internal ID | 18998889 | Source Database | TransTermHP TERM 65 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 65
|
| Sequence |
TGCCCCGCCGTGAAAACGGCGGGGCA Look for more occurrences |
| Start | 218524 |
| End | 218549 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas lini strain DSM 16768 8_312049_22.9628, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCACATAAAAAAA(5' tail) TGCCCCGCCGT(5' stem) TTTC(loop) ACGGCGGGGCA(3' stem) TTTTTATAACGTTGA(3' tail). Confidence: 100. opp_overlap 218524 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|