Internal ID | 18989830 | Source Database | TransTermHP TERM 43 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 43
|
Sequence |
CCCTGAATCGCAAGATTCAGGG Look for more occurrences |
Start | 207821 |
End | 207842 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens strain AU11114 Contig_60, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCAGGCATAAAAAAA(5' tail) CCCTGAATC(5' stem) TTGC(loop) GATTCAGGG(3' stem) TTTTCGGTATTTGGT(3' tail). Confidence: 100. opp_overlap 207821 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|