Internal ID | 18988807 | Source Database | TransTermHP TERM 8 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 8
|
Sequence |
CGCCCGGCCCTTTGGCCGGGCG Look for more occurrences |
Start | 38025 |
End | 38046 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens strain AU11114 Contig_12, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CACCGGAAACAAAAA(5' tail) CGCCCGGCC(5' stem) AAAG(loop) GGCCGGGCG(3' stem) CTTTTCTCAGGCAAT(3' tail). Confidence: 100. opp_overlap 38025 38024 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|