| Internal ID | 18987321 | Source Database | TransTermHP TERM 83 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 83
|
| Sequence |
GATCGGATCCCTTGGGGATCCGATC Look for more occurrences |
| Start | 424358 |
| End | 424382 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU13852 Contig_45, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCAGCGGCCACAGA(5' tail) GATCGGATCCC(5' stem) CAA(loop) GGGATCCGATC(3' stem) AGTAGGCTGGGCCCG(3' tail). Confidence: 100. overlap 424360 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|