| Internal ID | 18987055 | Source Database | TransTermHP TERM 13 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 13
|
| Sequence |
CACGCCGGTCCCCGTGACCGGCGTG Look for more occurrences |
| Start | 109919 |
| End | 109943 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU13852 Contig_39, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCCCTGAAACGCAA(5' tail) CACGCCGGTC(5' stem) ACGGG(loop) GACCGGCGTG(3' stem) GGGCTGGTGGGTCAG(3' tail). Confidence: 93. overlap 109914 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|