| Internal ID | 18985782 | Source Database | TransTermHP TERM 19 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 19
|
| Sequence |
CGCCCCGGCTCGAGTGAGCCGGGGCG Look for more occurrences |
| Start | 52866 |
| End | 52891 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU11136 Contig_16, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGAAGCCATAAAAAA(5' tail) CGCCCCGGCTC(5' stem) ACTC(loop) GAGCCGGGGCG(3' stem) TTTTTGTGTATGGCC(3' tail). Confidence: 100. opp_overlap 52866 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|