| Internal ID | 18985461 | Source Database | TransTermHP TERM 164 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 164
|
| Sequence |
CGCCCGGGCGAGATTCGCTCGGGCG Look for more occurrences |
| Start | 744248 |
| End | 744272 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU12597 Contig_9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACTGTGTAAAAAAAA(5' tail) CGCCCGAGCGA(5' stem) ATC(loop) TCGCCCGGGCG(3' stem) TTTTGAGGGCGATGC(3' tail). Confidence: 100. opp_overlap 744248, overlap 744208 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|