| Internal ID | 18985103 | Source Database | TransTermHP TERM 163 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 163
|
| Sequence |
CCGACCCATAAAATGGGTCGG Look for more occurrences |
| Start | 552051 |
| End | 552071 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU12597 Contig_35, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGCTGTTACCAA(5' tail) CCGACCCAT(5' stem) TTT(loop) ATGGGTCGG(3' stem) TTTTTTTTGCCTGAG(3' tail). Confidence: 93. opp_overlap 552037 552051 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|